Answer:
Area of river basins, portion in Western North Carolina River Basins Square Miles French Broad 2,830 Yadkin 1,900 Little Tennessee 1,797 Catawba 1,530 6 more rows ...
Explanation:
hopes this helps D:
Answer:
the answer is an increase in water pollution
Multiple Choice
A student observed bees flying between flowers on a squash vine. after researching this activity, the student learns that bees obtain nectar from the flowers. The pollen from the flowers sticks to the bees and is transported to another flower of the same species, resulting in pollination. The student decides this is an example of mutualism. Which table explains why this relationship is mutualism?
Answer:
The answer is D
Explanation:
Flowers and bees both benefit from pollination so D
Answer: that should be d
Explanation:
What is the meaning of the term metabolism?
Are enzymes needed for metabolism?
A. YES!
B. NO!
C. MAYBE SO!
D. ALL OF THE ABOVE (This option clearly makes no sense! Don't pick it!)
Answer:
YES! (Don't mean to yell, but those were the options.)
Explanation:
Enzymes break down food, and therefore, are needed for metabolism.
Stem cells in plants are referred to as?
1. merimex
2. meristems
3. stalk stem cells
4. special stem cells
Meaning of all of these words below (Will be appreciated! I really need help! 30points!!! ^^):
autotroph, heterotroph, producer, consumer, herbivore, carnivore, omnivore, scavenger, ecosystem, population, community, terrestrial ecosystem, marine ecosystem, aquatic ecosystem, biotic factor, abiotic factor, predator, prey, predation, competition, carrying capacity, limiting factor, decomposer
Autotroph: organism that is able to form a neutral organic substances heterotroph: an animal that can't make its own food supply producer: a person, company, or country that makes, grows and supplies goods consumer: a person or thing that eats or uses something herbivor: animal that eats off of plants carnivore: animal that eats meat or skin omnivore: animal that eats both plants and meat scavenger: a person who looks for missing items ecosystem: where organisms call home population: the number of people/living things in one area community: a group of people living around the same place terrestrial ecosystem: group of living organisms living on a land-based area marine ecosystem: under the sea where the salt levels are really high aquatic ecosystem: ecosystem of a body of water biotic factor: a non living part of an ecosystem that shapes an environment abiotic factor: non living physical and chemical elements in the ecosystem predator: an animal hunting for another animal to eat prey: the animal victim of a predator predation: the preying of one animal on others competition: an event or contest that people compete in carrying capacity: a species' average population size limiting factor : anything that is a population size decomposer: an organism that breaks down chemical
.
.
.
phew that was a lot. I hope you have a great day!!
A child has a mass of 30 Kg on earth. If the gravity on the Moon is one sixth that of the earth what is the mass of the child moon
Answer:
30 kilograms
Explanation:
A change in gravity does not affect mass.
A student examines a periodic table.
Which inferences about sodium (Na) are true?
Answer:
true c this is the answer
A student used a microscope to study four members of the phylum Ciliophora. Members of
this phylum move when propelled by hundreds of tiny cilia.
Paramecium
caudatum
Paramecium
aurelia
Os
ALLA
3220
Paramecium
bursaria
Paramecium
multimicronucleatum
VIITTEITA
Although these organisms belong to the same phylum, they are classified as different -
A families
B species
C kingdoms
D orders
Answer:
A
Explanation:
Makes the most sense
Although these organisms belong to the same phylum, they are classified as different families. Thus, option A is correct.
What is family?The family structure that is being described in the description above is step family structure. The step family is being formed by which one family ends with divorce and the individual is likely to get remarried, creating a blended or step family that is associated with two families that are separated.
Family of choice refers to the concept of family is intended to capture the commitment of chosen, not fixed, care and support. A family of choice is also known as chosen family and found family. It is a family that is made up of intentionally by chosing the members for love and support rather than blood. Basically, family of choice is that one in which people chose their member intentionally.
Therefore, Although these organisms belong to the same phylum, they are classified as different families. Thus, option A is correct.
Learn more about families on:
https://brainly.com/question/2284676
#SPJ6
Which of the following planets has the largest elliptical orbit?
A. Jupiter
B. Uranus
C. Saturn
D. Earth
What type of volcano is pictured below?
composite volcano
shield volcano
strato-volcano
cinder volcano
Answer:
the answer is the shield volcona
Make a key out of this picture, in other words differentiate between each.
Answer:
They are different due to their colour, number of petals, and shape of petals.
Explanation:
These flowers are different from one another because of their colour, number of petals, and shape of petals. Some flowers are pink in colour, some are white and others are yellow in colour. Some has five petals whereas some has four petals. Some petals of flowers has circular shape, some petals has pointed shape, while others are 'W' shape.
2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC
Which best describes the end result of meiosis?
O A. two diploid cells identical to the parent cell
o B. four haploid cells identical to the parent cell
C. two diploid cells different from the parent cell
D. four haploid cells different from the parent cell
A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong
A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.
What are gymnosperms?Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.
Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.
Find out more about gymnosperms here.
https://brainly.com/question/15158870
#SPJ2
What happens to chromosomes when an ovum and a sperm meet at fertilisation
Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.
Explanation:
Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion
Answer:
Secretion
Explanation:
Not completely sure tho, good luck
CTT GAC TGA TGC
3. Transcribe the DNA Strand (answer to previous question) to an mRNA strand:
(2 point)
Answer:
GAA CTG ACG
Explanation:
this will be the complementary DNA strand.
A=T
G=C
C=G
and above you will see the answer key for any DNA strand complementary.
disadvantages of pedigree analysis
One Multiple Choice (A, B, or C) question and one True/False question.
For probability and permutations and combinations
Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.
Answer:
D. Meiosis ensures a wider variety of genetic variation.
This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.
What are the two most common sources for rivers and streams?
Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.
Explanation:I did this in class 2 days ago LOL
Answer:
The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.
Explanation:
Hope this helped you :D
White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?
Answer:
Lysosome
Explanation:
Why do we not use a Punnett Square to determine the offspring for asexual reproduction? Is that form of reproduction diverse? Explain your answer.
Answer: There isn’t another organism to cross with
Explanation:
In asexual reproduction there is only one parent so all the genes come from one person.
Why do siblings always look different from each other even though they have the same parents? *
A. Siblings look exactly the same.
B. This is because there are always random mutations in everyone's DNA.
C. There is no reason, this is just random.
D. Due to meiosis, siblings each get slightly different genetic information from both parents.
which one ^
Answer:
Siblings look different cause of the genetics combining through child creation
Explanation:
what happens to most solar radiation when it gets to earth??
Answer:
Most of the solar radiation is bounced off of earth´s atmosphere.
Explanation:
Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.
the chief purpose of the photosynthetic process is considered to be the
The white blood cells in the lungs release protease. Suggest the function of this enzyme in the white blood cells in the lungs.
( Pls don't answer for points. Serious answers only )
Answer: Protease is an enzyme which causes break down of proteins by converting them into smaller polypeptides or amino acids.
Explanation:
Proteases are the enzymes that are necessary for the functioning of the lungs. They cause the regeneration and repair of white blood cells as protease can digest connective tissue elements. They are responsible for generating an inflammation response during infection caused by a pathogen. Thus prevents lung infection. Inhibition of the anti-proteolytic mechanism is essential for the controlling microbial infection and lung inflammation.
List 4 viruses and the diseases they cause (1 disease per virus) please help!!!!
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Archie Carr helped save turtles from extinction. What did he do during Operation Green Turtle?
A.) He made laws against hunting turtles.
B.) He took turtle eggs to safe beaches.
C.) He cleaned the turtles after an oil spill.
D.) He planted grasses that turtles eat.
Answer:B
Explanation:The project distributed green turtle eggs and hatchlings to various nesting beaches around the Caribbean and the Gulf of Mexico in an effort to encourage the growth of their dwindling populations. His conservation efforts also led him to lead campaigns against ocean pollution.