Which best describes the end result of meiosis?
O A. two diploid cells identical to the parent cell
o B. four haploid cells identical to the parent cell
C. two diploid cells different from the parent cell
D. four haploid cells different from the parent cell

Answers

Answer 1
D Four haploid cells different from the parent cell

Related Questions

Can someone help me with question 1 pls:)

Answers

answer:

c d e

good luck :)

hopefully, this helps

have a great day !!

how are brain skin and bone genetically related?

Answers

Explanation:

The brain, skin and bones are genetically related thru DNA.

Gene expression regulates differation of cells...

Draw a flowchart to illustrate how a change in a nucleotide in a DNA strand leads to symptoms experienced by those with sickle cell anemia.

Answers

Answer:

Explanation:

The Flowchart is in the picture below. I hope it would be helpful for you.

A nucleotide is a compound containing three component units namely a pentose sugar, a heterocyclic nitrogenous base and a phosphate group. The nitrogenous base present may be either purines or pyrimidine.

What is sickle cell anemia?

The sickle cell anemia is one of a group of inherited disorders known as the sickle cell disease. It affects the shape of the red blood cells which carry oxygen to all parts of the body. In sickle cell anemia some red blood cells are sickle shaped.

Red blood cells are usually round and flexible, so that they move easily through blood vessels. The sickle shaped red blood cells are also called crescent moons. These sickle cells also become rigid and sticky which slow or block the blood flow.

SCD causes a basal substitution of adenine A to thymine T in the sixth codon of beta globin. This leads to the replacement of glutamic acid with valine in polypeptide chains of haemoglobin.

The flowchart is given below:

To know more about sickle cell anemia, visit;

https://brainly.com/question/20892062

#SPJ2

3. (a) The binomial naming system used to identify all living things gives the Indian elephant
a scientific name of Elephas maximus.
Which part of this name refers to the genus and which part refers to the species?
genus
species
[1]​

Answers

Answer:

Genus = Elephas

Species = maximus

Explanation:

Carolus Linnaeus, who is considered to be the FATHER OF TAXONOMY for his immense contribution to the classification of living organisms. Carolus Linnaeus between the year 1735 and 1758, developed a scientific system of naming organisms using two-way naming system called BINOMIAL NOMENCLATURE.

The two Latin names given to organisms were derived from their generic and specific epithet i.e. one of the names is GENUS and the other SPECIES. According to this question, the scientific name using the binomial naming system for Indian elephant is Elephas maximus. This means that Elephas is the part that refers to GENUS while maximus is the part that refers to SPECIES.

In the diagram of the DNA molecule below, match the correct term with the image (ignore the blank arrow).

Answers

Answer:

hope this help

Explanation:

Nucleic acids are made up of chains of many repeating units called nucleotides (see bottom left of Figure 1 below). The DNA molecule actually consists of two such chains that spiral around an imaginary axis to form a double helix (spiral.)  Nucleic acid molecules are incredibly complex, containing the code that guarantees the accurate ordering of the 20 amino acids in all proteins made by living cells.  Surprisingly though there are only a few different nucleotides: only four different nucleotide units comprise DNA, the nucleic acid of interest to the genealogist.  

 

 

This figure is a diagram of a short stretch of a DNA molecule which is unwound and flattened for clarity. The boxed area at the lower left encloses one nucleotide.  Each nucleotide is itself make of three subunits:

A five carbon sugar called deoxyribose (Labeled S)

A phosphate group (a phosphorous atom surrounded by four oxygen atoms.) (Labeled P)

And one of four nitrogen-containing molecules called nucleotides . (Labeled A, T, C, or G)

 

 

 

Alternating sugar and phosphate units form the two sides of a ladder-shaped arrangement with the rungs or steps each formed by a pair of nucleotide bases. Figure 2 below shows the structural formula of DNA in greater detail. The nitrogen bases are ring compounds with their carbon and nitrogen atoms arranged in single or double rings.  Only certain bases can pair together to form base pairs.  In DNA, Adenine (A) always pairs with thymine (T), and guanine (G) always pairs with cytosine (C).  

Notice that in the two figures above, the two strands of a DNA molecule are antiparallel, that is, they run in different directions. The side of the chain on the left begins with a free phosphate group at the top and ends with a sugar molecule at the bottom.  In contrast, the complementary chain on the right begins at the top with a sugar molecule and ends at the bottom with a phosphate group.  

Happily, it is not necessary to hold the details of DNA structure in your mind at all times!   As the sugar and phosphate sides of the molecule are constant they are frequently represented by parallel lines.  Even better, each of the nitrogen bases is conveniently represented by the first letter of its name.  These conventions allow the simplified representation of the molecule shown in the figure below

Or, even easier, a section of a DNA molecule is often abbreviated to show the bases of just one strand:

A T G G C T A C

Knowing the base pairing convention of A always pairing with T and G always pairing with C makes the complementary strand of the molecule understood.  It is this feature of complementary base pairing that insures an exact duplicate of each DNA molecule will be passed to its daughter cells when a cell divides.

Jake is taking photos of his neighbor's home to help them list and sell the house. It is
important to have a wide variety of photos to choose from, so he is taking multiple
shots of each room--some from the doorways, some from floor-level, some from up
above, and some from a corner of the room. What is Jake playing around with as he
photographs each room?
O motivation
O decor
O lighting
O angles

Answers

The answer is Angles

If too many pandas are competing for bamboo (their food), what could happen?
there will always be enough for them to share
eventually there will no be enough bamboo for all
bamboo will keep growing back

Answers

Answer:

Eventually, there will no be enough bamboo for all

Explanation:

Answer B. Eventually, there will not enough bamboo for all.

Explanation:

Which is primary Pollinator of conifers?
A.birds B. Insects C.Wind D. Water​

Answers

Answer:

C)wind

Explanation:

All conifers are pollinated by wind. 

Answer:

wind

Explanation:

yan po ang sagot sana makatulong

100 POINTS AND BRAINLY IF CORRECT PLEASEE HELP ME

Answers

Answer:

A) Nitrogen is cycled through living and non-living components of the ecosystem.

Explanation:

Nitrogen cycles shows and tells you how it travels from plants, animals, bacteria, the air, and the soil. (Both living and non-living organisms.) Nitrogen has to go into different states to go through each organism, living and non-living.

a particle of oxygen has 8 protons and 8 electrons. is this an atom or an ion? what's the charge?

Answers

Answer: It is Atom and the charge would be postive.

Explanation: If the atom had 8 protons and 8 electrons (oxygen for example), knocking one of the electrons out, makes 8 protons and 7 electrons. The atom now has a net charge of +1 because the 7 electrons cancil the positive charges of 7 of the protons in the nucleus, but there is one remaining proton with a positive charge.Oxygen's 8 electrons are negatively charged, and they orbit the atomic nucleus and balance the positive charge of the 8 protons. The positive charge of 1 proton exactly cancels the negative charge of 1 electron. Answer 9: Oxygen is atomic number 8 on the periodic table, which means it has 8 protons!

Hope this helps :) Can u plz mark me branliest :)

A particle of oxygen has 8 protons and 8 electrons in an atom and the charge on it is zero.

What is an atom?

It is the smallest particle of matter composed of electrons and a nucleus of protons and neutrons.

What is an ion?

It is an atom with a positive or negative charge due to either loss or gain of electrons.

Every atom tends to have a noble gas configuration for stability and they either tend to lose, gain, or share electrons to achieve it.

The oxygen atom generally gains 2 electrons to complete its octet and has a net -2 charge.

To learn more about electrons and atoms here,

https://brainly.com/question/1488567

#SPJ2

Question 5
The diagram below shows a population of mice over time.
Original
Population After
Population
One Month
Next Generation
Which of the following statements is supported by the information in the diagram?
A
The light mice are poorly adapted to survive in any environment. Because of this, fe
genes.
The dark mice all have identical genes. Because of this, the dark mice were more li
B

Answers

Answer: its c btw :)

Explanation:

Your from Ms Cunningham class, I know :) I CAUGHT U

How does movement along faults change the Earth’s surface?

Answers

Step by Step Explanation

Earthquakes are the result of sudden movement

along faults within the earth that releases stored

up elastic strain energy in the form of seismic

waves that propagate through the earth and

cause the ground surface to shake..

Please mark as brainlist

PLEASE HELP ME

The greater the biodiversity in an ecosystem the
A. less likely the ecosystem is to survive
B. more likely the ecosystem will survive
C. less valuable it is to human, for various products
D. the more similar it is

Answers

B. because if you have a bio diverse ecosystem and an event happens, there will be organisms that survive and organisms that don’t

Answer:

I am pretty sure the answer is B

- I'm sorry of its not correct

Some students conduct an investigation in a biology lab by setting up four different artificial stomachs, each in a
40 °C water bath. The students place the same amount of boiled egg white, a protein-rich source, in each stomach.
They also add dilute hydrochloric acid, HCl, and pepsin, a digestive enzyme, to each stomach, as shown in the table.
The students observe the mass of egg white in each stomach every 15 minutes.
Which statement describes the most likely result of this investigation?
A. The mass of the Egg white increases as the volume of the enzyme increases.
B. The egg white is unaffected by the differing amount of enzyme.
C. Digestion decreases in each stomach as more of the egg white's surface area becomes exposed.
D. Digestion increases as the volume of the enzyme increases.

Answers

Answer: D. Digestion increases as the volume of the enzyme increases.

Explanation:

Enzymes speed up reactions by reducing the activation time of a reaction. If there are more enzymes therefore, the reaction will move faster.

Pepsin is an enzyme that prefers acidic conditions so it can work with dilute HCL. It can also work in temperatures of 40 °C without getting denatured. As more Pepsin is added therefore, the reaction will move faster and digestion will increase.

Answer: The answer would be D!!

Explanation:

In the laboratory, scientists remove the gene for insulin from human chromosomes. They insert the gene into the DNA of bacteria. This causes the bacteria
to produce human insulin. The insulin is used to treat diabetes in humans. Which of these describe this process?
A. Recombinant DNA
B. Reproductive Cloning
C. Gene Therapy
D. DNA Fingerprinting

Answers

Answer:

A. Recombinant DNA

Recombinant DNA is created by a process called genetic recombination. In this process, we insert a exogenous gene to let another organism, a bacteria in this case, produce a protein that can not be produced otherwise

What effect does burning fossil fuels during manufacturing and energy production have on outdoor air pollution?

Answers

Answer:

It causes global warming as well as air pollution.

Explanation:

Burning of fossil fuels has adverse effect on outdoor air pollution because when the fossil fuels burns carbondioxide gas is released in the atmosphere. Carbondioxide gas is a greenhouse gas which is released in the atmosphere through burning of fossil fuels and is responsible for increasing air pollution. This increase in carbondioxide gas leads to global warming due to blockage of solar radiation that is reflected from the earth surface.

The mass and______of an object affects the momentum of its motion.
a. destiny
b. shape
c. velocity
d. volume​

Answers

velocity

momentum = mass times velocity

what are the reactants of glycosis?

Answers

Answer:

Explanation:

The only true reactant of glycolysis is a molecule of glucose. Two molecules each of ATP and NAD+ (nicotinamide adenine dinucleotide, an electron carrier) are introduced during the series of reactions.

What should be the goals of managing forests?

Answers

Protect existing undeveloped forests and greenspaces from further development. Enhance the health, condition and function of existing tree and forest fragments to provide such things as air quality and temperature regulation, hydrologic function and habitat.

I hope this helps

State why parthenogenesis is considered a form of asexual reproduction

Answers

Answer:

Parthenogenesis is an asexual mode of reproduction, in which, an unfertilized egg develops into a new individual, occurring commonly among insects and certain other arthropods. form of asexual reproduction found in females, where growth and development of embryos occurs without fertilization by a male.

Explanation:

List some biotic and abiotic factors you would expect to find in a city park?

Answers

biotic factors such as trees, plants, animals like birds or dogs
abiotic factors such as rocks, benches, and soil

Will mark brainliest!

Answers

Answer:

true

Explanation:

What will happen to the red blood cell in this environment?
Group of answer choices

The red blood cell will swell from absorbing salt molecules.

The size of the red blood cell will remain constant.

The red blood cell will swell at first and then shrink.

The red blood cell will shrink from losing water molecules.

Answers

Answer:

Explanation:

A The size of the red blood cell will remain constant. B The red blood cell will swell at first and then shrink.

The red blood cell in this environment is the red blood cell will swell from absorbing salt molecules. Thus, option A is correct.

What is the salt concentration of red blood cell?

The red blood cell has a lower salt concentration than the liquid which means that it has a higher water concentration than the liquid. By the process of osmosis, water will flow from the red blood cell to the liquid which would lead to the red blood cell shrinking in size.

Cellular respiration has used to create energy for cells. It works by burning glucose in the presence of oxygen. The result is an outburst of energy and [tex]CO2[/tex] as well as water. Red blood cells that are bathed in blood neither shrink nor swell and burst because the concentration of the surrounding blood is equal to the concentration inside the cytoplasm of the red blood cells. This means that the two solutions are isotonic.

Therefore, The red blood cell in this environment is the red blood cell will swell from absorbing salt molecules. Thus, option A is correct.

Learn more about red blood cell on:

https://brainly.com/question/17890844

#SPJ2

1.What is precipitation that is more acidic than normal called?

2.The loss of most vegetation is a prominent cause of desertification. (T or F)

3.If we one part of an ecosystem, can we have an effect on the rest of the ecosystem? Explain.

4.How does human activity impact Earth's systems such as deforestation, urbanization,
desertification, erosion, air and water quality, and alternating the flow of water?
PLEASE ANSWER YOU WILL GET MARK THE BRAINIEST

Answers

Answer:

dweqdf ejlff

Explanation:

Investigators are looking for the igniter used at their crime scene. Which igniter is most likely to leave evidence behind for investigators to discover?

A cigarette lighter
A cigarette butt
A match
A Molotov cocktail

Answers

A cigarette lighter considering the suspect touched it and left fingerprints
A cigarette lighter because it would most likely cause fire out of all the other options listed

In guinea pigs, the allele for short hair (S) is dominant over long hair (s). If two heterozygous short-haired guinea pigs mate, what percentage of their offspring will have long hair?​

Answers

Answer:

75% long hair

Explanation:

If you use a table and put Ss for one parent on top and Ss one the side for the other parent you get the result of SS Ss Ss ss which means 75% long hair.

A teacher performs a demonstration of cellular transport by placing a raisin in pure water. After 24 hours, the students check the raisin and find that it has swollen and has a greater mass than before it was placed in the water.

Answers

Answer:

Explanation: it will swell after 24 hrs

The discovery that chromosomes are involved in inheritance was made possible by the invention of the -
O a. computer
O b. microscope
Oc microgram scale
O d. mercury thermometer

Answers

The answer would be the letter (B) the microscope.

why are enhinoderms and cnidarians are more closely related than enchinoderms and mammals

Answers

Answer:

Because they are triploblastic ( Triblastica ).

Explanation:

Their body is composed of endoderm, mesoderm and ectoderm. While Cnidaria are Diblastica, so they are composed only from two layers: endoderm and ectoderm.

In addition larvae of Echinoderms are bilaterally symmetrical and they become nearly-radial only as adults.

Which two body systems are interacting in the diagram?

Answers

Answer:

Where is the diagram pls?

Other Questions
6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9}