Using the quotient rule, what is the derivative of the function f(x)=(3x-5)/(5x+2)?​

Answers

Answer 1

Answer:

[tex]\frac{31}{(5x+2)^2}[/tex]

Step-by-step explanation:

See image for quotient rule

f(x)= numerator = 3x-5

g(x)= denominator = 5x+2

so we have

[tex]\frac{(5x+2)(3x-5)'-(3x-5)(5x+2)'}{(5x+2)^2}\\(3x-5)'=3\\(5x+2)'=5\\\frac{(5x+2)(3)-(3x-5)(5)}{(5x+2)^2}\\\frac{15x+6-(15x-25)}{(5x+2)^2}\\\frac{31}{(5x+2)^2}[/tex]

Using The Quotient Rule, What Is The Derivative Of The Function F(x)=(3x-5)/(5x+2)?

Related Questions

a shade of violet paint is made from 16 parts of blue paint mixed with 5 parts of red paint. If 4 cans of paint are used, how many cans of red paint should be used?

Answers

Answer: None because i dont like cans of paint

Step-by-step explanation: If you dont like cans then you wont like beans. So if d33z + nutz = d33znutz then cans + paint = canspaint

The second term in a sequence is 13. The term to term rule is "add 6"

Write an expression, in terms of n, for the nth term of the sequence.

Answers

Answer:

[tex]a_{n}[/tex] = 6n + 1

Step-by-step explanation:

This is an arithmetic sequence with nth term

[tex]a_{n}[/tex] = a₁ + (n - 1)d

where a₁ is the first term and d the common difference

Here a₁ = 13 - 6 = 7 and d = 6 , then

[tex]a_{n}[/tex] = 7 + 6(n - 1) = 7 + 6n - 6 = 6n + 1

Answer:

the first few terms would be

7, 13, 19, 25, 31

nth term = 7 + 6(n+1)

nth term = 7+ 6n + 6

nth term = 6n + 13

what is the possibility of going school on a saturday?​

Answers

Zero unless you have church school

Answer:

     I personally think there's a low chance of going to school on a Saturday since the only reason that I have in mind is that the student needed help catching up and completing their work. Another reason a student may go to school on a Saturday is because they're part of student senate/student council and they're planning for something there.

Hope I helped :)

Can someone help me understant this proof?​

Answers

Answer:

Yeah, you can prove with the use of alternate interior angles, alternate exterior angles, and parallel angles. That's why they're similar.

Step-by-step explanation:

Just take a picture and you’ll get the answer

At 111111:55\text{ p.M.}55 p.M.55, start text, space, p, point, m, point, end text, Thomas ties a weight to the minute hand of a clock. The clockwise torque applied by the weight (i.E. The force it applies on the clock's hand to move clockwise) varies in a periodic way that can be modeled by a trigonometric function. The torque peaks 151515 minutes after each whole hour, when the minute hand is pointing directly to the right, at 3\text{ Nm}3 Nm3, start text, space, N, m, end text (Newton metre, the SI unit for torque). The minimum torque of -3\text{ Nm}−3 Nmminus, 3, start text, space, N, m, end text occurs 151515 minutes before each whole hour, when the minute hand is pointing directly to the left.

Answers

The Torque function is T(t) = 3sin((t-5)π/30).

What is Torque?

When an engine exerts itself, torque, which is a twisting force, speaks to the rotational force of the engine and quantifies how much of that twisting force is accessible.

Given:

After 5 minutes Thomas ties it on, the torque is zero and increasing.

So, the sine function is shifted right 5 minutes.

and, The maximum value is 3.

Then, the multiplier of the sine function as the period is 60 minutes

Then, the coefficient of t = (2π/60)

                                         = π/30.

Hence, the Torque function is T(t) = 3sin((t-5)π/30).

Learn more about Torque here:

https://brainly.com/question/25708791

#SPJ5

Toni goes to a department store and buys two shirts marked the same price. She pays full price for the first shirt but gets a 40% discount on the second shirt. If she pays a total of $32.40 for the two shirts, how much did she pay for the second shirt? -Please give a real answer

Answers

Answe$12.15

Step-by-step explanation:

She paid 60% of the price...

x + .6x = 32.40

1.6x = 32.40

x=20.25

20.25 * .60 = 12.15

Hihi , please help if able.

Answers

Answer:

Step-by-step explanation:

Area of the rectangular garden is given by the expression,

Area = 6(2x + 5y)

By distributive property,

6(2x + 5y) = 12x + 30y

Therefore, equivalent expression for the area will be,

Area = (12x + 30y)

For x = 3 and y = 4,

Area = 12×(3) + 30×(4)

        = 36 + 120

        = 156

Area of the rectangular garden = 156 square feet.

What is the solution to the equation V8x = V4+2x ?
p= 2/5
p= 2/3
p= 24
p= 40​

Answers

Answer:

x = [tex]\frac{2}{3}[/tex]

Step-by-step explanation:

Given

[tex]\sqrt{8x}[/tex] = [tex]\sqrt{4+2x}[/tex] ( square both sides )

8x = 4 + 2x ( subtract 2x from both sides )

6x = 4 ( divide both sides by 6 )

x = [tex]\frac{4}{6}[/tex] = [tex]\frac{2}{3}[/tex]

PLEASE ANSWER ASAP!!

Roger bought some turkey and some roast beef for the soccer club picnic. He paid $110 for a total of 20 pounds of meat. The turkey cost $6 per pound, and the roast beef cost $5 per pound.

A) Create a system of equations that models the situation. Define the variables you use.

B) The graph shows one of the relevant equations in this situation. Draw the graph of the other relevant equation.

Answers

The answer is A because they did create a system

i need the answer plz​

Answers

Answer:

see explanation

Step-by-step explanation:

If (x - 1) is a factor then f(1) = 0

Given

f(x) = x³ - 13x² + 32x - 20 , then

f(1) = 1³ - 13(1)² + 32(1) - 20

     = 1 - 13 + 32 - 20

     = 0

Since f(1) = 0 then (x - 1) is a factor

Using Synthetic division

 1  | 1  - 13   32   - 20

      ↓    1   - 12      20    

     -----------------------------

      1    - 12   20     0 ← remainder

quotient = x² - 12x + 20 = (x - 2)(x - 10)

Then

x³ - 13x² + 32x - 20 = (x - 1)(x - 2)(x - 10) ← in factored form

     

The bus seats 36 people. The van seats 12 people. What portion of seats are van seats?

Answers

24
reason: 36-12=24
ez dubs

for the diagram below, which equation is the correct use of the distance formula?

Answers

Answer:

????

Step-by-step explanation:

Where's the equation? diagram?

Answer:

How we supposed to answer with no equation

Step-by-step explanation:

If 3x = y - 5 and x = -4, then y =

plz show work ​

Answers

Answer: y= -7

Step-by-step explanation:

Step 1: Simplify both sides of the equation.

(3)(−4)=y−5

−12=y+−5

−12=y−5

Step 2: Flip the equation.

y−5=−12

Step 3: Add 5 to both sides.

y−5+5=−12+5

y=−7

[tex]\huge\text{Hey there!}[/tex]

[tex]\large\textsf{3x = y - 5}\\\\\large\textsf{3(-4) = y - 5}\\\\\large\textsf{3(-4) = \boxed{\bf -12}}\\\\\large\textsf{-12 = y - 5}\\\\\large\textsf{TURN the EQUATION}\\\\\large\textsf{y - 5 = 12}\\\\\large\textsf{ADD 5 to BOTH SIDES}\\\\\large\textsf{y - 5 + 5 = -12 + 5}\\\\\large\textsf{CANCEL out: -5 + 5 because that gives you 0}\\\large\textsf{KEEP: -12 + 5 because that gives you the y-value}\\\\\large\textsf{y = -12 + 5}\\\\\large\textsf{-12 + 5 =\boxed{\bf -7}}[/tex]

[tex]\boxed{\boxed{\large\textsf{Answer: \huge \bf y = -7}}}\huge\checkmark[/tex]

[tex]\large\text{Good luck on your assignment and enjoy your day!}[/tex]

~[tex]\frak{Amphitrite1040:)}[/tex]

The average low temperatures in January are given for a few cities. Arrange the cities in increasing order of their temperatures. Barrow -19°F Littlefork -9°F Boston 22°F Topeka 20°F Chicago 18°F

Answers

Answer:

Barrow

Littlefork

Chicago

Topeka

Boston

Step-by-step explanation:

Freezing point is 0° while boiling point is 100°

Temperatures below  0° are very cold and temperatures greater than  0° are warmer compared to temperatures  below  0°

The coldest would be barrow

the next is Littlefork

Then Chicago and Topeka and Boston

Answer:

BarrowLittleforkChicagoTopekaBoston

Step-by-step explanation:

Hi!! I hope you are having a good day. I’m having an exam rn and I need help, these are short answers.

1. The radius of a circle is 14 cm. If π is taken as 3.14; what is the circumference of the circle.

2. Calculate: 2 3/6 + 3/6 =

3. Damarie and Breanna share a reward of $117 at a ratio 1:8. What was Breanna's share?

4. Razon is constructing a decagon shape motel; each side measuring 12.4 cm. As the contractor, calculate the perimeter of this motel.

5. Using the division method, find the prime factors of 42? State if this number is odd or even.

6. Complete the the number sequence 1, 3, 10, 21, 64, 129_____, 777.

7. Using the factor three method, list the prime factors of 68 *

8. Don- tae decided to ship a container to JM to stock his Supermarket. The length of the container is 16.3 m , breadth 8 m and height 6. 2 m. Calculate the volume of this container.

9. A circle has a circumference of 44 cm, given that π 22/7, calculate the its diameter.

Answers

Answer:

1.) 88cm

2.) 3

3.)104

Step-by-step explanation:

1) circumference= 2πr

2×22/7×14 = 88cm

The rectangle has length 4.5cm and width 2.8cm. Work out the area ​

Answers

Answer:

11/1//11/1

Step-by-step explanation:

Area of rectangle= l x b
= 4.5 x 2.8
= 12.6 cm^2

(20x2 – 12x) + (25x– 15)
4x(5x – 3) + 5(5x – 3)

Answers

Answer:

4   5

Step-by-step explanation:

I got it right here.

The factored form of (20x² – 12x) + (25x– 15) is (4x+ 5)( 5x- 3).

What is Factorize?

The process of breaking or decomposing an entity (such as a number, a matrix, or a polynomial) into a product of another entity, or factors, whose multiplication results in the original number, matrix, etc., is known as factorisation or factoring.

Given:

(20x² – 12x) + (25x– 15)

or, 4x(5x – 3) + 5(5x – 3)

or, (4x+ 5)( 5x- 3)

Hence, the factored form of (20x² – 12x) + (25x– 15) is (4x+ 5)( 5x- 3).

Learn more about factorize here:

https://brainly.com/question/14067703

#SPJ2

The area of a rectangular field is 7626m2. If the length of the field is 93m, what is its width?

Answers

Answer:

The width is [tex]82m[/tex]

Step-by-step explanation:

------------------------------>>>>

The formula to find the area of a rectangle is [tex]A=lw[/tex]

We already know the area of the rectangular field which is [tex]7626m[/tex]

We already know the length is [tex]93m[/tex]

--------------->>>>

Now let's substitute [tex]7626[/tex] for [tex]A[/tex] because that's the area and substitute [tex]93[/tex] for [tex]l[/tex] because that's the length. After that, let's solve to find the width.

[tex]7626=93w[/tex]

Divide both sides by 93 because that's the opposite of multiplication.

[tex]82=w[/tex]

--------------->>>>

This means that the width of the rectangular field is [tex]82m[/tex]

Hope this is helpful

PLEASE ANSWER ASAP :"( I need to submit the homework and i dont understand how to do the solution

p/s PLEASE READ THIS pls ignore the another language just read the english one..​

Answers

Answer:

x      -2      -1       0      1

y      -1       2        5      8

Step-by-step explanation:

y=3x+5

When x=-2

y=3(-2)+5

y=-6+5

y=-1

when x=-1

y=3(-1)+5

y=-3+5

y=2

whenx=0

y=3(0)+5

y=5

When x=1

y=3(1)+5

y=3+5

y=8

Which expression is equivalent to 24 1/3? A. 2 square root 3 B. 2(3 square root 3) C.2 squareroot 6 D 2(3 square root 6) (look at image please)​

Answers

Answer: Its B

Explanation: took the quiz

[tex]\longrightarrow{\pink{ B. \:2\sqrt[3]{3} }}[/tex] 

[tex]\sf \bf {\boxed {\mathbb {STEP-BY-STEP\:\:EXPLANATION:}}}[/tex]

[tex]= {24}^{ \frac{1}{3} } [/tex]

[tex] = \sqrt[3]{24} [/tex]

[tex] = \sqrt[3]{2 \times 2 \times 2 \times 3} [/tex]

[tex] = \sqrt[3]{ ({2})^{3} \times 3} [/tex]

[tex] = 2\sqrt[3]{3} [/tex]

[tex]\red{\large\qquad \qquad \underline{ \pmb{{ \mathbb{ \maltese \: \: Mystique35♛}}}}}[/tex]

78% of a certain food is fat. Out of 100 total grams, how many grams are
not fat?

Answers

22 Djdjdjdjcncjfjfbcc

Write the equation of the parabola in vertex form.

I'll give you 52 points if you answer this

Answers

Try y = (x - 2)^2

to be completely honest i just plugged this into a calculator

Please help 7th grade math

Answers

Answer:

x=20, g=100, f=80

Step-by-step explanation:

when ever somthing is suplementary it means the the answer will euqal to 180 degrees. That means your equation is going to be

3x+40+5x-20=180

8x+20=180

8x=160

x=20

Finding g

3(20)+40

60+40

g=100

FInding f

5(20)-20

100-20

f=80

Calculate the Kinetic Energy when the mass of the car is 1,200kg and the speed
is 11.11 m/s. ​

Answers

Answer:

74059.3 J

Step-by-step explanation:

KE = I/2mv²

KE = 1/2(1200)(11.11)²

KE = 1/2(1200)(123.4321)

KE = 74059.26 J

Answer

74059.26J

Explanation

Formula

EK=mv^/2

m=1200kg

v=11.11m/s

E=1200kg×(11.11m/s)^/2

E=74059.26J

Factor the answer
8y-16

Answers

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

[tex]8(y-2)[/tex]

»»————- ★ ————-««  

Here’s why:

⸻⸻⸻⸻

[tex]\boxed{\text{Simplifying the Expression:}}\\\\8y-16\\------------------\\\rightarrow 8y-16\\\\\text{8 is a common factor in the terms. Pull out 8 to factor...}}\\\\\rightarrow \boxed{8(y-2)}[/tex]

⸻⸻⸻⸻

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

Answer:

We can not find the answer with with equation since there is no comparison sign. To demonstrate this lets look at a way we could solve this equation.

8y-16=32

8y=48

y=6

Please help I’ll give brainliest

Answers

Answer:

a) 421mm² = 0.000421 m²

b) 9.3kg²= 9,300,000 g²

c) 25kL²= 25,000,000 L²

d) 1439m²= 0.001439 km²


What is the multiplicative rate of change of the
function?

Answers

Answer:

0.25×5=0.125

0.125×0.5=0.0625

0.0625×0.5=0.03125

the multiplicative rate of chage of the function is 0.5

Pls help I’ll give brainless

Answers

Answer:

108.56

Step-by-step explanation:

First find the amount of the tip

92 * 18%

92 * .18

16.56

Add this to the amount of the bill

92+16.56

108.56

Answer:

108.56

Step-by-step explanation:

92$ + .18*92 = 108.56$

xy + x3 ( That 3 is cube )

Answers

And the question is?

help help helpppppppppp

Answers

Answer:

28 answer write ✍️ now ok

Other Questions
Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here. ng lc qu trnh truyn khi l g? Khi qu trnh truyn khi xyra, ng lc truyn khi xy ra nh th no ? Which best explains whether a triangle with side lengths 2 in., 5 in., and 4 in. is an acute triangle?The triangle is acute because 22 + 52 > 42.The triangle is acute because 2 + 4 > 5.The triangle is not acute because 22 + 42 < 52.The triangle is not acute because 22 < 42 + 52. Based on the short story Phaethon; pretend you are Phaethon in the afterlife, write a letter (at least two paragraphs)to your father telling him how you feel about having asked to ride his chariot.PLEASE NO LINKS!!! The figure below is made of 2 rectangular prisms.What is the volume of this figure? The perimeter of a rectangle is 58 inches and the area is 180 square inches. Find the dimensions of the rectangle. illings and collections between an Enterprise Fund and the General Fund A city uses an Enterprise Fund to provide electricity to its citizens and to its General Fund. A total of $50,000 was billed to the General Fund and collected 30 days later. Prepare the journal entries necessary to record these transactions, and label the fund(s) used. Note: Under the Fund column, select the appropriate fund in which the transaction is recorded (GF: General Fund or ISF: Internal Service Fund).