Riddle #3 of today:

In 1990, a person is 15 years old
In 1995, the same person is 10 years old

How can this be?

lol i dont know the answer to my own riddle
first who answers correct gets brainliest!

Have a great day folks!
:)

Answers

Answer 1

The years are in B.C (Before Christ).

Thus, 1990 in BC will gives 15 years old and 1995 in BC will gives 10 years old.


Related Questions

22
Select the correct answer.
A student is writing an argumentative text about recess for high school students. The student makes the claim that recess is important for high
school students because physical activity relieves stress and stimulates the brain as high school is a challenging environment.
Which example would best support the student's claim?
ОА.
research from the U.S. Dept. of Health and Human services highlighting the benefits of physical activity
an info graphic about explaining how teenagers should deal with challenges
OB.
ос.
a student's blog post about experiences in high school
OD
interview with a school guidance counselor about the importance of taking challenging courses
Reset
Next
entum. All rights reserved.
^ ( 00
12:11 PM
3/18/2021

Answers

Answer: A

Explanation:

A - credible and relevant. correct on edmentum,

B - wrong b/c  isn't really related to stress and physical activity

C - wrong b/c blogs may be unreliable, isn't really related to stress and physical activity

D - blogs may be unreliable, isn't at all related to stress and physical activity

An example that would best support the student's claim is research from the U.S. Dept. of Health and Human services highlighting the benefits of physical activity and an infographic explaining how teenagers should deal with challenges. Thus the correct option is A.

What is Claim?

A claim refers to proving something in the absence of evidence by providing arguments in order to win a conversation. This claim is based on assumption and does not provides factual information.

In the given excerpt, the student claims about an issue that physical activity relieves stress and helps to the brain as high school is providing a complicated atmosphere.

To support this claim one needs enough evidence which is proved from research from any credible source which provides authentic information which proves the point.

The US dept of health highlights the benefits of physical activity and the challenges faced by teenagers help to prove the claim. Therefore, option A is appropriate.

Learn more about the claim, here:

https://brainly.com/question/22898077

#SPJ5

the cell phone alarm on vibrate sounded like a jackhammer on Rachels wooden nightstand what figurative language is that
a simile
b metephor
c personifacation
d hyperbole

Answers

Answer:

a. simile

Explanation:

it is a simile because it uses the word "like" to compare two different things

According to evolutionary theory and Natural Selection teenagers are better able to"______________."

Answers

Answer:

Understand the concept of evolution and natural selection.

Explanation:

The teenagers are better able to understand the selection of organism by the nature and the reasons for evolution. In natural selection only those organisms survive that adopted the environmental conditions and those which can't adopt the environment extinct from the ecosystem. Evolution occurs in the organism due to change in the heritable features of biological populations over successive generations.

who is narrator in the story- devils of rose hall

Answers

Answer: First Person narrator lily

Explanation:

What personal qualities are necessary to see things as someone else does ?

Answers

Answer:

There are three main factors in helping one see things through another's Point of View. They are Compassion, Understanding and Past Experience.

Explanation:

Compassion is a great factor because it is vital to understand the feelings of the person as he went through the event. If another's loved one has passed away, one should imagine that his own loved one has passed away, and the feeling would be the same.

Understanding is another factor. It is vital to understand the situation and facts fully before being able to put oneself into another's shoes.

Finally, Past Experience is an important factor as well. For example, if one was born without knowing who his parents were, he could not understand the feeling of losing a parent. As such, he is unable to understand the feeling when another loses his parents.

compassion, experience , understanding

see the photo and answar.​

Answers

shielded

distant

embarrassed

teasing

HELP PLZ!!!!!!!!


Read the poem and answer the question.

[1]I wandered lonely as a cloud
That floats on high o'er vales and hills,
When all at once I saw a crowd,
A host, of golden daffodils;
[5]Beside the lake, beneath the trees,
Fluttering and dancing in the breeze.

Continuous as the stars that shine
And twinkle on the milky way,
They stretched in never-ending line
[10]Along the margin of a bay:
Ten thousand saw I at a glance,
Tossing their heads in sprightly dance.

The waves beside them danced; but they
Out-did the sparkling waves in glee:
[15]A poet could not but be gay,
In such a jocund company:
I gazed—and gazed—but little thought
What wealth the show to me had brought:

For oft, when on my couch I lie
[20]In vacant or in pensive mood,
They flash upon that inward eye
Which is the bliss of solitude;
And then my heart with pleasure fills,
And dances with the daffodils.

Line three signals a tone shift from sadness to ______________________.

concern
curiosity
humor
wonder

Answers

Your answer should be d

The theme of sickness runs throughout Act II. Name some of the ways in which this idea is used. What point do you think Shakespeare makes by continually referring to this theme

Answers

That he is talking and saving the people of the world

How does George relate to Lennie (Mice and Men)

Answers

Answer:

George and Lennie have a relationship like a master and his dog. George is responsible for Lennie, making sure he has work, food, and does not get into too much trouble

hes like a master for lennie

george tells lennie what to do but if lennie disobeys he scoulds him

Do you feel like there places you can't say what you really think? Or do what you really want? Example: in the book they aren't allowed to read books. They will be killed. Is there a place in this world where that happens? Where people aren't free. Tell me about what you know about that. ​

Answers

Answer: I would say the Zonarch zone or manarch zone but forgot the name but they have to cover up there entire face and theres whole bunch of bad people and you have to look it up and it's very dangours or another place is north koroe

Explanation:

please I want help in this​

Answers

Answer:

Hey,

So The other day I went to the mall and as I was walking into the clothes store, I ran into someone. As we began to talk, we had a lot in common and they were pretty funny. They have a really good personality, too. We talked and joked around a little bit and I think that you would like them as well. We exchanged numbers before they left the store. You are really funny and really sweet and I think that you guys would get along because you both have a lot in common. We are all also closely related in age and in the same grade, so we can all relate to a lot of things. Maybe we can all go hang out somewhere some time. what do you think?

Which statement best describes how the footnote supports the paragraph?

Answers

Answer:

more info

Explanation:

Answer:

its c because i took the test yester day

Raw celery has a slight sparkle, a zingy taste that you don't get in cooked celery. When Mrs. Gleason came around with the relish tray, we each took another stalk of celery, except my brother. He took two.What does the word stalk mean in this sentence?
walk away angrily
salty taste
cooked quickly
piece of a plant

Answers

Piece of a plant. :)

Answer:

piece of a plant

Explanation:

a stalk in this case is a stalk of celery/ a piece of celery.

Why does Zaroff think Rainsford is “droll” and “naïve”? (Paragraph 116) A. Zaroff thinks it’s foolish and old-fashioned that Rainsford values human life even after fighting in the war. B. Zaroff thinks it is childish and immature that Rainsford has never tried to kill another human. C. Zaroff judges Rainsford’s American culture because Rainsford feels a religious sense of responsibility. D. Insane Zaroff has been isolated on the island for too long and laughs madly at seeing Rainsford, another civilized man.

Answers

Answer:A

Explanation:

I got it right on the test.

Zaroff thinks Rainsford is “droll” and “naïve” as Zaroff thinks it’s foolish and old-fashioned that Rainsford values human life even after fighting in the war.  Thus the correct option is A.

Zaroff is surprised and amused by Rainsford's remark, saying, "You'll find this game worth playing... your opinion of me will fundamentally change... you'll find it droll..." I bet you'll abandon your concepts of decency... I have no qualms about destroying them."

Rainsford's belief in the value of human life, according to Zaroff, is outmoded and naive given the conditions, when killing humans is merely a game.

Therefore, option A is appropriate.

Learn more about Zaroff, here:

https://brainly.com/question/31895154

#SPJ6

Light is diffused when it passes through the translucent material.

true or false
An opaque material is one that allows only a small amount of light to pass through it.

true or false
Light is diffused when it passes through the translucent material.

true or false

Answers

1)True
2)true
3)true

Simon asked his dad if he'd been to south africa
Write the sentences as direct speetch

Answers

Answer:

Simon asked his dad, "Have you been to South Africa?"

Hope this helped! <3

Please answer only if you have read Julie of the Wolves! Give a reasonable explanation! I will give brainliest to the first correct answer that has an explanation!
Which sentence best describes the importance of the setting of Julie of the Wolves?

It is so harsh that it may cause the protagonist's death.

It represents the way the protagonist feels about life.

It will teach the protagonist key things about her past.

It provides a pleasant backdrop for a difficult situation.

Answers

Answer:

A. It is so harsh that it may cause the protagonist's death.  

Explanation:

The setting of Julie of the Wolves was somewhere in Northern Alaska and it was set on open ground in cold harsh weather and this setting is important because It is so harsh that it may cause the protagonist's death

Hi.
I need help with my Project.Its due in 3 days time. English isn't my first language.

Question : You are a speaker in a debate on the motion “Modern movies do not provide Young people with a good model of human behaviour” .
Write your speech for or against the motion.​

Answers

Perhaps take from my answer. Sorry if this isn't good, i'm a bit tired. You can add on and change up the words. I was unsure what was exactly wanted for this.

Answer:

Hello, as the speaker of this, I say the motion is correct. Modern movies are run by acting and scripts, while people are off script and anything could truly happen. Younger people tend to leach from what they see on T.V. and from elders, thus certain movies may give them bad views. Say with common action movies: That would most likely give the person a taste of violence as an answer. Humans can be violent, but are not always fighting like how thrillers and action movies show. People do break out into fights, just not like that. If someone was trying to figure out how some commonly interact and behave from a movie, it wouldn't be a good choice, since that would provide the wrong view. Unless it's a documentary or educational film, modern movies do indeed give a bad model. It is understandable for others to have different opinions on this matter, this is my own. Thank you for your time.

What is the purpose of the Bill of Rights?

Answers

Answer:

The Bill of Rights is the first 10 Amendments to the Constitution. It spells out Americans' rights in relation to their government. It guarantees civil rights and liberties to the individual—like freedom of speech, press, and religion

Answer:

It guarantees civil rights and liberties to the individual. It sets rules for due process of law and reserves all powers not delegated to the Federal Government to the people or the States.

In animal farm (Chapter 9): What privileges do the pigs have that the other animals do not?

Answers

pretty much the pigs have all say and what goes on so they can change the rules and they can basically deceive the others without them knowing it

The child sneaked like a ninja past the sleeping dog. is an an example of:

A.Metaphor

B.Similie

C.Personification

D:Hyberbole

E:Idiom

F;Symbol




H.Simile

I.

Answers

Answer:

Simile.

Used the word like and is comparing the child to a ninja

I feel angry because my brother steal my ice cream. I feel happy because my brother didn't steal my ice cream.

How to join the two sentences into one sentence only¿

Pls I need some answer even it is wrong. It doesn't matter! ​

Answers

Joining two simple sentences into another simple sentence

Sentence synthesis means combining two or more simple sentences into one new sentence. ...

By using infinitives.

We can combine these two sentences into one using a to-infinitive.

By using a noun or phrase in apposition.

By using a participle.

We can combine two simple sentences into one by using a present or past participle

Absolutely no one expected it to happen. They painstakingly planned so it absolutely wouldn't-couldn't happen. But here they were, less than five hundred feet from the moon, and just about plumb out of fuel. Which detail from the excerpt best identifies the problem? no one expected it to happen just about plumb out of fuel they painstakingly planned five hundred feet from the moon

Answers

Answer:

B, "just about plumb out of fuel".

Explanation:

I'm assuming this book is Team Moon: How 40,000 people landed Apollo 11 on the moon by Catherine Thimmesh.

This book describes events that are stated as part of your question. All 4 of those options are technically correct, there's only 1 that is absolutely correct.

The first option describes how the problem was; the third option describes how the trip/landing was planned out; and the fourth option states how far away the ship was from the moon.

The question is asking for which option BEST IDENTIFIES the problem. Not how it was, not how it was planned, and not some facts about how far away the ship was.

Therefore, option B (Just about plumb out of fuel) is the best option.

Best of luck :3

Answer: I got A on mine

Explanation:

What text structure is the passage Madam cj Walker written in?

Answers

Answer:

It is written in a formal writing

Explanation:

also tell me if I'm wrong but don't troll with links just stop

3. Words in use.
a. Is it correct?
Example: A man who has good manners is ill-mannered
It's wrong. An ill-mannered man has bad manners.
1. A man who is not sure of himself is self-confident. ....
2. A man who is always polite is tactless. ....
3. A man who thinks only of himself is selfish. ....
4. A man who likes to live in a city is a suburban man. ....
5. A man who easily loses control of himself is very touchy.....
b. Match the words and their explanations below.
honest hard-working polite
rude dishonest lazy
1. You can say this about a person who says "please" and "thank you".
2. You can say this about a person who always works much.
3. Someone who lies or steals.
4. Someone who never lies or steals.
5. Someone who doesn't like to work.
6. Someone who is not polite.​

Answers

Answer:

1. It is wrong (false).

2. It is wrong (false).

3. It is correct (true).

4. It is wrong (false).

5. It is correct (true).

Part B.

1. Polite.

2. Hard-working.

3. Dishonest.

4. Honest.

5. Lazy.

6. Rude.

Explanation:

1. A man who is not sure of himself is self-confident. .... It is wrong.

A man who is self-confident is sure of himself.

2. A man who is always polite is tactless. .... It is wrong.

A man who is always rude is tactless.

3. A man who thinks only of himself is selfish. .... It is correct.

4. A man who likes to live in a city is a suburban man. .... It is wrong.

A man who likes to live in a city is an urban man.

5. A man who easily loses control of himself is very touchy..... It is correct.

Part B.

1. Polite: You can say this about a person who says "please" and "thank you".

2. Hard-working: You can say this about a person who always works much.

3. Dishonest: Someone who lies or steals.

4. Honest: Someone who never lies or steals.

5. Lazy: Someone who doesn't like to work.

6. Rude: Someone who is not polite.

help me bro like please i really wanna pass

Answers

Answer:

1 no. I guess...so i hope u will be pass

Answer:

it identifies the problems the soldiers faced while trying to keep the bear.

Explanation:

the whole passage is talking about how the bear had to become a soldier or else they couldn't keep the bear.

help tyyyy it’s due today

Answers

Answer:

For example

Explanation:

You're giving an example of which galaxy the Earth is in.

Anyone good at English help me plz

Answers

Answer:

Good advice

To be frank, I agree with you

When organizing this text, why did the author MOST LIKELY choose to add the content in paragraph 2 following the introduction?
es
A)
B)
The author had to provide his own opinion about pollution before
providing the facts.
The author provided the most interesting information first to gain readers'
attention.
By explaining how people can prevent pollution, he is offering a solution
for readers.
In order to discuss effects of pollution, the readers should understand what
pollution is.
C)
D)

Answers

Answer: D

Explanation: I did the usa test prep :)

In order to discuss effects of pollution, the readers should understand what pollution is. The correct option is D.

What is introduction?

The term "introduction" refers to the opening or start of a presentation, written piece, or other type of communication. It establishes the tone for the remaining content and works to grab the audience's interest.

An engaging hook or opening line, a succinct and clear thesis statement or presenting goal, and a quick summary of what the audience may expect to learn or gain from the content are all typical components of a strong introduction.

It's critical to provide readers a thorough knowledge of what pollution is in order to discuss its effects.

The presence or introduction of dangerous compounds into the environment that have the potential to harm ecosystems, living things, and natural resources is referred to as pollution.

Thus, the correct option is D.

For more details regarding introduction, visit:

https://brainly.com/question/26523961

#SPJ6

How does "This Is America" raise awareness for police brutality, racism, etc?

Answers

I'm guessing this is about the song by Childish Gambino

tw// shooting


It raises awareness by showing how media and entertainment muffle police brutality and racial injustices. This is shown multiple times in the video, first when Childish Gambino shot the guitar player and then immediately a dance sequence was shown. The dance distracts the mind from what just happened, and as time goes on, you slowly forget there was a shooting at all. Then, again, he shoots at a group of singers. This again is followed up by dancing.
The video shows how the human brain is easily distracted by and forgets real problems when entertainment is shown. Media outlets gloss over racial injustices and then move on to 'entertaining' topics to make you forget, sort of how a muzzle silences a dog.
Other Questions
Fill in the blank in the following sentence with "en" or "Y"as appropriate.J___ vais.yen b(1)= -12b(n)=b(n1)4Find the 3rd term of the sequence. Show me the solutions and calculations. un debate sobre temas controversiales como lalegalizacin de las drogas, la homosexualidad, la eutanasia y lamigracin. Toma en cuenta estructura. 7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-