Since the round seed gene is the dominant gene, it follows that, a cross between a round seed plant and a wrinkled seed plant will lead to only round seed offspring.
What is genetics?Genetics is the science that studies the patterns of inheritance. The unit of inheritance located in the chromosome is called the gene.
Since the gene for having round seeds is dominant over the gene for having wrinkeled seeds, a cross between a round seed plant and a wrinkled seed plant will lead to only round seed offspring.
Learn more about genetics:https://brainly.com/question/12985618
A type of ribonucleic acid that Incodes genetic information
Answer:
Explanation:
Cellular organisms use messenger RNA (mRNA) to convey genetic information (using the nitrogenous bases of guanine, uracil, adenine, and cytosine, denoted by the letters G, U, A, and C) that directs synthesis of specific proteins. Many viruses encode their genetic information using an RNA genome.
Hello people ~
Niche overlap indicates
(a) mutualism between two species
(b) active cooperation between two species
(c) sharing of one or more resources between the two species
(d) two different parasites on the same host
Answer:
(c) sharing of one or more resources between the two species
Explanation:
The total interaction of a species with its environment, or its functional position or status in an ecosystem, is referred to as its ecological niche. The structural adaptations, physical responces, and behaviour of a species determine its ecological niche.
I am joyous to assist you at any time.
Without the greenhouse effect, temper on Earth would (F) be too cool or too hot. G) become constant. (H) increase sharply. (I) vary too much.
Answer: (F): Be too cool or too hot.
Explanation: The Greenhouse Effect on Earth is a process of when gases in the atmosphere capture the heat produced by the Sun. Without the Greenhouse Effect, the heat reflected by Earth's surface would be lost in space. The temperature on Earth would drop drastically low and this could lead to oceans/lakes freezing over and some living organisms to die out. This would make most life incapable of living on Earth.
R 16 (050SMC)
Primary production isted in much of the open ocean by low levels of won, which is a necessary phytoplankton rent it has been suggested by some that pumps could be placed in these
phytoplankton blooms. What problem uma mpact) do you think scientists would be trying to address with this biotechnological approach?) ponto)
would move on her from the deep to the
whole thing
O Reduction in Iron pollution in ocean sediments
O Reduction of bycatch
Reduction of the greenhouse gas carbon dioxide in the atmosphere
Reduction of the human impact on marine species diversity
Answer: Reduction of the greenhouse gas carbon dioxide in the atmosphere
Explanation:
phytoplankton use photosynthesis to take the sun’s light waves and convert it into energy. They also take carbon dioxide and convert it into oxygen for other organisms to breathe.
descirbe the weather conditions associated with warm and cold fronts. why do these conditions differ
Answer:
A cold air front is where a cold air mass replaces warm air. The different air masses do not mix because of different densities.
Explanation:
Calculate the amount of energy needed to increase 0. 500l of water from 25. 0c to 35. 0c
Answer:
yeet
Explanation:
Planning an investigation
Design your own experiment to test how your body changes du changes in heart rate, breathing rate, or any other parameter occurring during exercise.
Part A First, formulate a question to answer through scientific investigation. Keep in mind that you should be able to answer your question with measurable data. Write your question here.
Answer:
An experiment to check a person's fitness is designed. The below mentioned parameters are checked
how is dna copied in your own words?
Answer:
Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. DNA replication is one of the most basic processes that occurs within a cell. Each time a cell divides, the two resulting daughter cells must contain exactly the same genetic information, or DNA, as the parent cell. To accomplish this, each strand of existing DNA acts as a template for replication.
Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Several enzymes and proteins then work together to prepare, or prime, the strands for duplication. Finally, a special enzyme called DNA polymerase organizes the assembly of the new DNA strands. The following description of this three-stage process applies generally to all cells, but specific variations within the process may occur depending on organism and cell type.
Answer:
website answer... the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment.
Explanation:
in my own words... the double helix and the separation of dna strands and the priming temlete strand and the assembly of a brand new dna segment
The rabies virus is capable of entering the brain with the blood of a victim of the bite of an infected animal. Propose a mechanism for this to happen.
This is clear demonstration that neurons are not like other cells and that they need a unique environment to thrive and function properly. It also protects neurons from blood-borne proteins, cells and toxic factors.
How much of the suns radiation does earth receive?
Answer:
The Earth receives about 71% of the suns radiation. About 29% of that radiation is actually reflected back into space.
Explanation:
Hope this helps:)
Answer this pls!!!!!!!
What do enzymes do?
Answer:
Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down.
Explanation:
how are organisms separated
Answer:
prezgotic and postzygotic barriers
Explanation:
according to the biological species concept, organisms belong to the same species if they can interbreed to produce viable, fertile offspring. Species are separated from one another by PREZGOTIC AND POSTZGOTIC BARRIERS, which prevent mating or the production of biable, fertile offspring.Answer:
Organisms separate using a cellular process that replicates chromosomes and produces two identical nuclei in preparation for cell division. Generally, mitosis is immediately followed by the equal division of the cell nuclei and other cell contents into two daughter cells.
scientific explanation of how a trait like less pigmentation became common in populations that live far from the equator
Answer:
selection favored lighter skin
Explanation:
This delicate balancing act explains why the peoples that migrated to colder geographic zones with less sunlight developed lighter skin color. As people moved to areas farther from the equator with lower UV levels, natural selection favored lighter skin which allowed UV rays to penetrate and produce essential vitamin D.
can i have brainliest juice~
Combine these amino acids into a tripeptide. Add or remove atoms and bonds as needed
Tripeptides such as Glycine-Alanine-Serine consists of three amino acids linked together by peptide bonds.
What are amino acids?Amino acids are the monomer units fro which proteins are made. Amino acids consists of a central carbon atom with
an amino group,a carboxyl group, a hydrogen atom anda side chain group all bonded to the central carbon atom.Peptides are formed when two or more amino acids are joined together by means of a peptide bond.
A tripeptide is a peptide consisting of three amino acids linked. An example of a tripeptide is: Glycine-Alanine-Serine.
Therefore, a tripeptide such as Glycine-Alanine-Serine consists of three amino acids.
Learn more about peptides at: https://brainly.com/question/24326041
A Tripeptide may be defined as a peptide consisting of three amino acids joined together by peptide bonds. Glutathione is a common tripeptide that consists of Glutamine-Cysteine-Glycine.
What do you mean by Amino acids?Amino acids may be defined as the building blocks of proteins which are consist of both a carboxyl (—COOH) and an amino (—NH2) group.
In Glutathione, three amino acids are joined together by a peptide bond to form a tripeptide. During the joining of two amino acids, a molecule of water is released.
Therefore, it is well described above.
To learn more about Peptides, refer to the link:
https://brainly.com/question/17089864
#SPJ4
Match the key terms to their corresponding definition!
Answer:
Denature - Break down, Substrate- What an enzyme acts on, Inhibitor- Decrreeses activity, Transition state- Highest energy
Explanation:
How does a comparison of bone structures of two animal provide evidence of an evolutionary relationship
Answer: Comparative Anatomy
Both provide evidence for evolution. Homologous structures are structures that are similar in related organisms because they were inherited from a common ancestor. These structures may or may not have the same function in the descendants.
Explanation: hope it helps
mark me as brainliest ^_^
Over the course of evolution, the bones of the animals undergo a gradual change in shape as well as in size. But still, two closely related animals have an identical overall layout of the bone.
What do you mean by Evolution?Evolution may be defined as a gradual process that involves changes or modifications in the members of the same or different species over a long period of time.
The bones of descent common ancestors reveal the evolutionary relationships among the animals. In relationship involves homologous and analogous structures.
The homologous structure reveals the structural similarity between the animals, while the analogous structures reveal the functional similarity.
Therefore, it is well described above.
To learn more about Evolutionary relationships, refer to the link:
https://brainly.com/question/26125007
#SPJ2
If the same object was taken to each of the planets, where would it weigh the most, and where would it weigh the least?
Answer:
answer in the link.
Explanation:
Describe two ways that the carbohydrates are used in the ecosystem.
Answer:Organisms use carbohydrates produced by photosynthesis by oxidizing them to produce energy for respiration
Explanation:Organisms use carbohydrates produced by photosynthesis by oxidizing them to produce energy for respiration. – The glucose produced in green plants is directly utilized for respiration and other activities, while the excess is stored in the form of starch.
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
What do you mean by Transcription?Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).
Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.
Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ4
Can someone please help me? :( I’ll give brainliest!!
Answer:
I Think it is B
but i can really see what D is saying
How is ocean acidification important to the world?
Answer:
Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.
In what phase of meiosis does crossing-over take place? why is crossing over important?.
Answer:
prophase I
Explanation:
This is important because it increases genetic variation.
hope this helps
pls mark brainliest
Mitosis and meiosis are both forms of cell division. The results of mitosis and meiosis are very different. Meiosis results in _____, while mitosis results in _____.
A) 4 haploid cells; 2 diploid cells.
B) 4 diploid cells; 2 haploid cells.
C) 2 diploid cells; 1 haploid cell.
D) 2 haploid cells; 1 diploid cell.
I'm pretty sure its C forgive me if im wrong.
Explanation:
According to the histogram, how many shipments had more than 20 light bulbs broken? A) 4 B) 6 C) 7 D) 12
The histogram depicts that the number shipments that had more than 20 light bulbs broken is D. 12.
What is a histogram?A histogram simply means a graphical representation that is used to organize a group of data points into ranges.
From the complete question, the histogram shows that the number shipments that had more than 20 light bulbs broken is 12. This can be interpreted based on the ranges shown in the histogram.
Learn more about histogram on:
https://brainly.com/question/1581651
Answer:
7
Explanation:
I did the USA test prep!!
true or false:
genotype affects phenotype by providing the instructions for making proteins
What causes scientists to disagree?
O A. Some scientists are better than others.
B. They have unique perspectives and skills.
C. Scientists disagree to get attention.
O D. Many scientists do not use the scientific process.
Answer:
B. They have unique perspectives and skills.
Which group contains only innate physical defenses?.
Answer:inflammatory response, phagocytosis, natural killer cells, and the complement system.
Explanation:
What do statements are true about a punt square
Answer:
Punnett squares predict the probability of different genotypes in offspring
Hope it helps
TC
have a great Time
What is the first step in the cell cycle?
Answer:
Prophase
Explanation:
parent chromosomes are condensed into an x shape
Answer:
The cell cycle is a four-stage process in which the cell increases in size (gap 1, or G1, stage), copies its DNA (synthesis, or S, stage), prepares to divide (gap 2, or G2, stage), and divides (mitosis, or M, stage). The stages G1, S, and G2 make up interphase, which accounts for the span between cell divisions.
Explanation:
pa brainlest
What causes a river delta to form?
A. deposits of sediment
B. a newly formed mountain
C. a convergent plate boundary
D. a divergent plate boundary
Answer:
A
Explanation:
Deposists of sediments causes river delta, that is carried by a river as the flow exits its mouth and enters slower-moving or stationary water such as ocean, sea, and lakes.