Answer:
ovulation phase
Explanation:
The ovulation phase is the only time during your menstrual cycle when you can get pregnant. You can tell that you're ovulating by symptoms like these: a slight rise in basal body temperature
d) ovulation phase
Its called ovulation due to the egg leaving to ovary to then be fertilized by a sperm. Although it is possible for a woman to get pregnant during anytime in her cycle. I hope this helped a bit.
The temperature of the earth's surface during different seasons is also affected by
the passage of the sun's rays through the atmosphere.
True
False
Answer:
True
Explanation:
The sun's light rays produce heat which is actually the only reason why we are not living in a block of ice.
Winter is when we are farther from the sun thus it is colder than the summer when we absorb more of the sun's rays.
The statement "the temperature of the earth's surface during different seasons is also affected by the passage of the sun's rays through the atmosphere" is definitely true.
What is an Atmosphere?An atmosphere may be characterized as a type of layer that significantly consists of a mixture of numerous gases that surrounds any celestial body or planet like the earth, mars, etc. The atmosphere of the earth is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.
The rays of the sun typically produce a significant amount of heat. Due to this, we are not living in a block of ice and get a source of energy directly from the sun.
During winter, the sun is farther from the surface of the sun, so we receive less amount or indirect light but in summer, we absorb more of the sun's rays. Due to this, the temperature increases and we feel extremely hot outside.
Therefore, the statement "the temperature of the earth's surface during different seasons is also affected by the passage of the sun's rays through the atmosphere" is definitely true.
To learn more about Atmosphere, refer to the link:
https://brainly.com/question/24925283
#SPJ6
HELP ME
MARKING BRANELIST
Answer:
I think the answers probably b
Which resource is nonrenewable? A. Wind B. Trees C. Coal D. Soybeans
Which of these genotypes represents a carrier?
Аа
aa
XXY
AA
Answer:
Aa
Explanation:
from what I can remember from 7th grade science
PLEASE HELP ME!!!!!!!
Answer:
The last one
Explanation:
they enjoy being alone and quiet for a small-time what are they?
Answer:
Introverts enjoy being alone because of acetylcholine) this chemical in the brain might induce a kind of happy feeling, for the introvert.
How is dopamine involved in drug addiction?
1) drugs change dopamine into another neurotransmitter.
2) drugs cause the reabsorption of dopamine.
3) drugs decrease dopamine levels in the brain.
4) drugs increase the level of dopamine in the brain
Answer and I will give you brainiliest
Answer:
The correct answer is - option D.
Explanation:
When an individual takes drugs such as heroin, nicotine, cocaine and methamphetamine increases or promotes the neurochemical reaction that increases the amount of dopamine which is a primary factor in addiction that is secreted by neurons in the brain's reward center.
Higher dopamine levels lead to pleasure in the mind of an addict and it makes people forget the pain or stress and gives immense pleasure.
Thus, the correct answer is - option D.
in drosophila melanogaster, the common fruit fly, curved wings "I" and purple eyes "r" are two linked recessive genes found on chromosomes 2. The dominant wild type alleles for those genes are long wings"L" and red eyes "R"
a)describe the expected ratio of offspring in the f2 generation of these genes were located on different chromosomes
b)the results in the f2 generation of these flies were: 40 long winged, red eyes; 40 curved winged, red eyes; 10 long winged, purple eyes, and 10 curved winged, red eyed. how many map units apart are the genes for curved wings and purple eye color?
Answer:
the other person is right, he had messed up before saying that 60 x 40 = 100, but 60 + 40 = 100. Then I had told him that his answer was wrong and that he should put the answer as 240 instead since 60 x 40 = 240 and not 100.
Explanation:
The expected ratio of offspring in the f2 generation of these genes were located on different chromosomes is 25%
What are chromosomes?A chromosome is a long DNA molecule with part or all of the genetic material of an organism. In most chromosomes the very long thin DNA fibers are coated with packaging proteins; in eukaryotic cells the most important of these proteins are the histones.
Chromosomes allow DNA to be accurately copied during these cell divisions. So one more time. Chromosomes are found in the nuclei of our cells and allow DNA to be accurately copied during cell division.
Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA).
Learn more about chromosomes:
https://brainly.com/question/21297190
#SPJ2
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
Which hot and dry biome is home to large herds of herbivores that feed on many types of grasses?
Answer:
grasslands
Explanation:
Which term indicates that a single gene has two or more alleles present in a population?
A. Genotype
B. Point mutation
C. Polymorphism
D. Pleiotrophy
Genetic polymorphism is the existence of multiple alleles of a single gene.
What are genes?Genes are regions of DNA which code for a particular protein or any other gene product.
Genes can exists as a single copy or as multiple copies.
Alleles are alternate forms of a particular gene.
A single gene that has two or more alleles present in a population is known as genetic polymorphism.
Therefore, multiple alleles of a single gene is known as genetic polymorphism.
Learn more about genes at: https://brainly.com/question/1480756
#SPJ2
Which feature of the Earth's surface is caused by wind?
A)
rock quarries
B)
canyons
C)
sand dunes
for
D)
mountains
Answer:
b canyons
Explanation:
Transcription is the process of making
Which is an adaptation that helps birds maintain a stable body temperature?
air sacs connected to lungs
large chest muscles
down feathers
nearly hollow bones
Answer:
the answer is down feathers. Or C
Explanation:
I just took the unit review test
Sexual harassment in the workplace is a crime when committed by anyone, regardless of position, role, or gender. Please select the best answer from the choices provided ОТ OF
Answer:
The answer is true.
In a professional environment, sexually degrading comments and actions are legally prohibited.
Which statement is true about a red brick?
A red brick reflects red light and absorbs blue and green light.
O A red brick reflects blue light and absorbs red and green light.
A red brick reflects green light and absorbs blue and red light.
O A red brick reflects blue and green light and absorbs red light.
Answer:
1. red brick reflects red light and absorbs blue and green light.
The statement which is true about a red brick is: A. A red brick reflects red light and absorbs blue and green light.
An electromagnetic spectrum refers to a range of frequency and wavelength that an electromagnetic wave is distributed (extends).
Generally, an electromagnetic spectrum comprises the following radiations:
Gamma rays.Ultraviolet radiation. X-rays. Radio waves. Infrared radiation.Visible light.A visible light can be defined as the range of electromagnetic radiation or wavelength that the human eye can detect or see.
Also, the colors of the visible light spectrum are:
Red.Orange.Blue.Indigo.Green.For a red brick, all red light would be reflected while the other colors such as blue and green light are absorbed.
Read more: https://brainly.com/question/23419308
B. Suspension c. Solution
D. Saturated solution
5. Which is a solvent in a cup of coffee?
A. coffee
B. creamer
c. sugar
D. water
6. Why should you shake the liquid medicine before drinking?
A. To make it effective. C. To mix the suspended particles at the bottom.
B. To make it taste better. D. To make it clear.
7. What should be done in a liquid medicine before drinking it?
A. Drink right away after opening. C. Let it stand for 3 minutes
B. Shake well
D. All of these
8. Which of the following is called a universal solvent?
A. water 8. gasoline C. juice D. diesel
m-Directions: For items 1-5 What method are you going
Answer:
5.c 6.c 7.b 8.a
Explanation:
I hope it helps u :)
can anyone answer that
Answer:
1. Short-term energy storage
2. Lipids
3. Speed up chemical reactions, support cell's structure
4. Nucleic acids
Explanation:
The image comprising of a tabular representation portrays the four biological molecules, their building blocks and function. The four biological molecules in nature are carbohydrates, proteins, lipids and nucleic acids.
- Carbohydrates are biological polymers made up of monomers called monosaccharides. They function to store energy in cells for a short period of time. Examples are glucose, starch etc.
- Lipids are formed from monomers called FATTY ACIDS. They function in the long term storage of energy. Examples are phospholipids, fats etc.
- Proteins are formed from monomers called AMINO ACIDS. They provide various functions including speeding up of chemical reactions, provide cellular structure support etc. Examples are haemoglobin, melanin, hormones etc.
- Nucleic acids are polymers of NUCLEOTIDES. They function majorly in the storage of genetic information. Examples are DNA, RNA etc.
Based on scale of 100 and represents average performance
Answer:
Ok what is the question good sir/madam?
Answer:
Explanation:
Yes i agree with the other answer SIr or Ma'am but i don't know if this question!
describe how you would test a sample of powdered milk to see if it contained protein
Answer:
How would you contained protein
Explanation:
One would test a sample of powdered milk to see if it contained protein by using copper sulfate solution and sodium hydroxide solution.
What is protein?A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.
An essential component of a balanced diet is protein. Amino acids are the chemical "building blocks" that make up proteins.
Amino acids are used by your body to create hormones, enzymes, and to build and repair muscles and bones. They can be utilized as a source of energy as well.
The test can be done as:
To your meal solution, add a few drops of copper sulfate solution. A few drops of sodium hydroxide solution should be added. Protein is present in the food if the solution becomes purple.Thus, using copper sulfate solution and sodium hydroxide test, one can determine the protein content in the sample.
For more details regarding protein, visit:
https://brainly.com/question/29776206
#SPJ2
Linnaeus based one of his classification categories on plants. He even named the Kingdom Plantae. Which best describes the organisms in this kingdom?
A. They are autotrophic and have eukaryotic cells
B. They are made of prokaryotic cells
C. They are multicellular and do not have cell walls
D. They are always single celled and produce their own food
Answer:
b
Explanation:
all plants are make of prokaryotic cells.
What evidence do we have that all continents were merged into one super-continent called Pangaea 250 million years ago?
Glacial deposits, specifically till, of the same age and structure are found on many separate continents that would have been together in the continent of Pangaea. Fossil evidence for Pangaea includes the presence of similar and identical species on continents that are now great distances apart.
What is AB?
A
12
B.
C
35
Answer:
hah? i don't get it
Explanation:
You are studying brain cells and you discover a protein neurotransmitter that you
think might be useful. You know the amino acid sequence of the neurotransmitter.
Explain:
a) how you would isolate and identify the neurotransmitter gene
b) how you would produce multiple copies of the gene for study
c) how you would produce large quantities of the neurotransmitter to see if it could be
used as a potential medication.
e
Because it's most resistant to deterioration, which type of molecule is most often found in molecular fossils?
A. RNA molecules
B. Protein molecules
C. DNA molecules
D. Lipid molecules
Answer:
Of the four main groups of organic molecules, Lipids are the most resistant to decay. They are also highly insoluble in water. All cells produce this type of organic compound to be used in their membranes and in energy storage. These type of organic molecules are found in kerogens
In ancient times, people believed Earth was the center of the Solar System. Which of the following makes the geocentric model impossible?
O The moon revolves around Earth.
O Earth's gravitational force is much less than the Sun's.
o Orbits are elliptical, not circular
There are other planets that are closer to the Sun.
Exam Guidelines
Exam Instructions
Question 13 of 20 :
Select the best answer for the question
13. What molecular cloning tool do bacteria naturally produce to defend against viral infections?
O A. DNA ligase
O B. Restriction enzymes
O C. Antibiotics
O D. PCR
Mark for review (Will be highlighted on the review page)
Si
Type here to search
о
Answer:
O B. Restriction enzymes
Explanation:
Restriction enzymes has the ability to recognize specific DNA sequences and cut them in a specific manner in order to produced by the bacteria as a defense mechanism against foreign DNA containing substance such as viruses etc. This restriction enzyme is also called restriction endonucleases. This is a cloning tool that bacteria produced naturally in order to defend itself from the infection of virus.
Given a DNA sequence of ACG, what would be the corresponding RNA sequence? Once you determine the RNA sequence, what would be the corresponding amino acid for the RNA codon? Would a change in one nucleotide of the DNA alter the corresponding amino acid? Explain.
Answer:
- RNA sequence: UGC
- Amino acid sequence: Cysteine
- Yes, a change in nucleotide will alter the amino acid.
Explanation:
According to this question, a DNA sequence was given as follows: ACG. The process of transcription will produce a RNA sequence from this DNA sequence using complementary base pairing i.e. A-U, G-C etc. Based on this, the mRNA sequence that will result of the DNA sequence above is UGC.
The resulting mRNA transcript is a codon (three nucleotides) that will be used in the process of translation to yield an amino acid. The mRNA sequence: UGC codes for amino acid Cysteine.
- A change in one nucleotide of the DNA will alter the corresponding amino acid because DNA sequence in a particular reading frame is responsible for the production of amino acid. Hence, a slight change in nucleotide might change the reading frame of the sequence and hence give rise to a different amino acid.
Ethylene, a hormone found in plants, is produced to ripen fruits. These fruits ripen and drop to the ground where they release seeds. Which two plant systems are interacting when this occurs?
Answer:
Response and reproduction system
Explanation:
the children prepared a juice drink for their food festival by dissolving powdered juice in water what kind of mixture did they form? a. colloid b. suspension c. solution d. saturated solution